Search found 14 matches

by Cynops
Thu Feb 28, 2019 6:04 pm
Forum: Mellel
Topic: Tables and 4.2 changes to come
Replies: 0
Views: 182

Tables and 4.2 changes to come

I use tables a lot and I'm looking forward to the announced changes coming in 4.2. That said, I use Mellel as a note book and I have a relatively huge document that has 100+ tables. The new version will be fully backward compatible, right?

I was just working and had your basic omg moment...
by Cynops
Mon Nov 19, 2018 6:07 pm
Forum: Mellel
Topic: Right arrow and tab stops
Replies: 2
Views: 361

Re: Right arrow and tab stops

It's fixed. Cool
by Cynops
Mon Oct 22, 2018 6:16 pm
Forum: Mellel
Topic: Right arrow and tab stops
Replies: 2
Views: 361

Right arrow and tab stops

Okay this is odd. I use the four arrows for moving about a document quite a bit. The up, down & left arrows work like you would expect. The right arrow doesn't. It can't get past a tab stop. It's like it hits a wall. Is this just my computer or is this a bug? It is version 4.1.3b1 on OS 10.13.6.
by Cynops
Wed Aug 29, 2018 8:22 pm
Forum: Mellel
Topic: Merge several documents in one
Replies: 6
Views: 3785

Re: Merge several documents in one

I don't want to link the documents. I want to copy and paste from one into another. I can do the text just fine but it doesn't move the images and as they are all floating images edited in Mellel going back to the original images and placing & editing them one by one is a royal pain.
by Cynops
Tue Aug 28, 2018 9:24 pm
Forum: Mellel
Topic: Merge several documents in one
Replies: 6
Views: 3785

Re: Merge several documents in one

Is this still the case? Is there any way to drop an entire file (text, images, tables) into another file as a chapter?
by Cynops
Tue Jul 03, 2018 8:17 pm
Forum: The Nitty and the Gritty
Topic: Feature request: Text wrap around table
Replies: 3
Views: 829

Feature request: Text wrap around table

It would be very helpful to be able to wrap text around tables in the same fashion as around images.
by Cynops
Wed Jun 06, 2018 1:40 am
Forum: Mellel
Topic: Text wrap around table
Replies: 2
Views: 578

Text wrap around table

Is it possible to have text wrap around a small table? Or have an image next to a table?

And the forum search engine really doesn't like the word table....
by Cynops
Sat May 02, 2015 12:34 am
Forum: The Nitty and the Gritty
Topic: iCloud...
Replies: 4
Views: 6924

Re: iCloud...

More on the whole iCloud thing. I'm thinking this is more Apple sandboxing but it doesn't make a whole lot of sense to me. I've got a couple computers one running 10.9.5 and the other running 10.10.idon'tremember. Both machines have Mellel 3.3.8. Why can't the 10.10 machine see the files the 10.9.5 ...
by Cynops
Thu Oct 24, 2013 6:30 pm
Forum: Mellel
Topic: On 10.9 Mellel crashes on start
Replies: 9
Views: 3395

Re: On 10.9 Mellel crashes on start

I'm getting a new MacBook in a couple of days that will be running OS 10.9.

Does Mellel work as I need to be typing immediately.

Really basic words on a page typing, no interfacing with other programs or anything but I need to keep writing.
by Cynops
Sun May 12, 2013 3:45 am
Forum: The Nitty and the Gritty
Topic: iCloud...
Replies: 4
Views: 6924

iCloud...

I'm a bit confused about the iCloud support. It seems rather limited in that while it works quite well for what it is, well, it seems awfully limited. I move file to iCloud and they land in a list, sortable in OS 10.8, not so much in 10.7. There doesn't seem to be any kind of way of making a folder ...
by Cynops
Mon May 06, 2013 8:50 pm
Forum: The Nitty and the Gritty
Topic: Switching between upper and lower case
Replies: 2
Views: 3167

Re: Switching between upper and lower case

That worked perfectly. Problem solved.

Thank you.
by Cynops
Sat May 04, 2013 10:34 pm
Forum: The Nitty and the Gritty
Topic: Switching between upper and lower case
Replies: 2
Views: 3167

Switching between upper and lower case

I can't figure out how to do this: Much of my work involves DNA sequences which I just treat as text. One of the things that I do quite a bit is convert part of a sequence from upper to lower case. Taking this: TATTAGGGATAATAT TCACGCCAGAATGCGTTCGCACA and changing it to this: TATTAGGGATAATAT tcaCGCCA...
by Cynops
Mon Jan 28, 2013 10:12 pm
Forum: Mellel
Topic: Missing cursor next to picture
Replies: 3
Views: 1517

Re: Missing cursor next to picture

The problem persists in version 3.1.

Oh well.
by Cynops
Wed Jan 02, 2013 9:06 pm
Forum: Mellel
Topic: Missing cursor next to picture
Replies: 3
Views: 1517

Missing cursor next to picture

My documents have quite a few inline images on the left side of the page with the image causing the text to wrap on the right side. The images are rather tall and skinny so there can be half a page or more of text next to the picture. The problem I have is the first character next to the picture, th...