Search found 20 matches

by Cynops
Sun May 12, 2013 3:45 am
Forum: The Nitty and the Gritty
Topic: iCloud...
Replies: 4
Views: 8085

iCloud...

I'm a bit confused about the iCloud support. It seems rather limited in that while it works quite well for what it is, well, it seems awfully limited. I move file to iCloud and they land in a list, sortable in OS 10.8, not so much in 10.7. There doesn't seem to be any kind of way of making a folder ...
by Cynops
Mon May 06, 2013 8:50 pm
Forum: The Nitty and the Gritty
Topic: Switching between upper and lower case
Replies: 2
Views: 3860

Re: Switching between upper and lower case

That worked perfectly. Problem solved.

Thank you.
by Cynops
Sat May 04, 2013 10:34 pm
Forum: The Nitty and the Gritty
Topic: Switching between upper and lower case
Replies: 2
Views: 3860

Switching between upper and lower case

I can't figure out how to do this: Much of my work involves DNA sequences which I just treat as text. One of the things that I do quite a bit is convert part of a sequence from upper to lower case. Taking this: TATTAGGGATAATAT TCACGCCAGAATGCGTTCGCACA and changing it to this: TATTAGGGATAATAT tcaCGCCA...
by Cynops
Mon Jan 28, 2013 10:12 pm
Forum: Mellel
Topic: Missing cursor next to picture
Replies: 3
Views: 2231

Re: Missing cursor next to picture

The problem persists in version 3.1.

Oh well.
by Cynops
Wed Jan 02, 2013 9:06 pm
Forum: Mellel
Topic: Missing cursor next to picture
Replies: 3
Views: 2231

Missing cursor next to picture

My documents have quite a few inline images on the left side of the page with the image causing the text to wrap on the right side. The images are rather tall and skinny so there can be half a page or more of text next to the picture. The problem I have is the first character next to the picture, th...