Forum

I'm getting a new MacBook in a couple of days that will be running OS 10.9.

Does Mellel work as I need to be typing immediately.

Really basic words on a page typing, no interfacing with other programs or anything but I need to keep writing.

I'm a bit confused about the iCloud support. It seems rather limited in that while it works quite well for what it is, well, it seems awfully limited. I move file to iCloud and they land in a list, sortable in OS 10.8, not so much in 10.7. There doesn't seem to be any kind of way of making a folder ...

That worked perfectly. Problem solved.

Thank you.

I can't figure out how to do this: Much of my work involves DNA sequences which I just treat as text. One of the things that I do quite a bit is convert part of a sequence from upper to lower case. Taking this: TATTAGGGATAATAT TCACGCCAGAATGCGTTCGCACA and changing it to this: TATTAGGGATAATAT tcaCGCCA...

The problem persists in version 3.1.

Oh well.

My documents have quite a few inline images on the left side of the page with the image causing the text to wrap on the right side. The images are rather tall and skinny so there can be half a page or more of text next to the picture. The problem I have is the first character next to the picture, th...