Switching between upper and lower case

Feature requests, and in-depth discussions of features and the way Mellel works

Moderators: redlers, Eyal Redler, Ori Redler

Post Reply
Cynops
Got the styles thing figured out
Posts: 14
Joined: Sun Nov 27, 2011 1:45 am

Switching between upper and lower case

Post by Cynops » Sat May 04, 2013 10:34 pm

I can't figure out how to do this:

Much of my work involves DNA sequences which I just treat as text. One of the things that I do quite a bit is convert part of a sequence from upper to lower case. Taking this:

TATTAGGGATAATATTCACGCCAGAATGCGTTCGCACA

and changing it to this:

TATTAGGGATAATATtcaCGCCAGAATGCGTTCGCACA

Or some such thing. In other programs I can just highlight a stretch of characters and click on an upper case or lower case button and it changes it for me. Does Mellel have this switch? I can't find it if it does.

rpcameron
Knows everything, can prove it
Posts: 978
Joined: Wed Oct 26, 2005 12:48 am
Location: IE, CA, USA

Re: Switching between upper and lower case

Post by rpcameron » Sun May 05, 2013 3:20 pm

Not really. There are services you can install Devon Technologies' freeware WordService, which puts those options in the Services menu where they can be accessed from any application. But Mellel does not provide this ability itself.
— Robert Cameron

Cynops
Got the styles thing figured out
Posts: 14
Joined: Sun Nov 27, 2011 1:45 am

Re: Switching between upper and lower case

Post by Cynops » Mon May 06, 2013 8:50 pm

That worked perfectly. Problem solved.

Thank you.

Post Reply

Who is online

Users browsing this forum: No registered users and 3 guests