I can't figure out how to do this:
Much of my work involves DNA sequences which I just treat as text. One of the things that I do quite a bit is convert part of a sequence from upper to lower case. Taking this:
TATTAGGGATAATATTCACGCCAGAATGCGTTCGCACA
and changing it to this:
TATTAGGGATAATATtcaCGCCAGAATGCGTTCGCACA
Or some such thing. In other programs I can just highlight a stretch of characters and click on an upper case or lower case button and it changes it for me. Does Mellel have this switch? I can't find it if it does.
Switching between upper and lower case
Moderators: Eyal Redler, redlers, Ori Redler
-
- Knows everything, can prove it
- Posts: 980
- Joined: Wed Oct 26, 2005 12:48 am
- Location: IE, CA, USA
Re: Switching between upper and lower case
Not really. There are services you can install Devon Technologies' freeware WordService, which puts those options in the Services menu where they can be accessed from any application. But Mellel does not provide this ability itself.
— Robert Cameron
Re: Switching between upper and lower case
That worked perfectly. Problem solved.
Thank you.
Thank you.