Switching between upper and lower case
Posted: Sat May 04, 2013 10:34 pm
I can't figure out how to do this:
Much of my work involves DNA sequences which I just treat as text. One of the things that I do quite a bit is convert part of a sequence from upper to lower case. Taking this:
TATTAGGGATAATATTCACGCCAGAATGCGTTCGCACA
and changing it to this:
TATTAGGGATAATATtcaCGCCAGAATGCGTTCGCACA
Or some such thing. In other programs I can just highlight a stretch of characters and click on an upper case or lower case button and it changes it for me. Does Mellel have this switch? I can't find it if it does.
Much of my work involves DNA sequences which I just treat as text. One of the things that I do quite a bit is convert part of a sequence from upper to lower case. Taking this:
TATTAGGGATAATATTCACGCCAGAATGCGTTCGCACA
and changing it to this:
TATTAGGGATAATATtcaCGCCAGAATGCGTTCGCACA
Or some such thing. In other programs I can just highlight a stretch of characters and click on an upper case or lower case button and it changes it for me. Does Mellel have this switch? I can't find it if it does.