I'm getting a new MacBook in a couple of days that will be running OS 10.9.
Does Mellel work as I need to be typing immediately.
Really basic words on a page typing, no interfacing with other programs or anything but I need to keep writing.
Search found 21 matches
- Thu Oct 24, 2013 6:30 pm
- Forum: Mellel
- Topic: On 10.9 Mellel crashes on start
- Replies: 9
- Views: 10409
- Sun May 12, 2013 3:45 am
- Forum: The Nitty and the Gritty
- Topic: iCloud...
- Replies: 4
- Views: 11308
iCloud...
I'm a bit confused about the iCloud support. It seems rather limited in that while it works quite well for what it is, well, it seems awfully limited. I move file to iCloud and they land in a list, sortable in OS 10.8, not so much in 10.7. There doesn't seem to be any kind of way of making a folder ...
- Mon May 06, 2013 8:50 pm
- Forum: The Nitty and the Gritty
- Topic: Switching between upper and lower case
- Replies: 2
- Views: 4881
Re: Switching between upper and lower case
That worked perfectly. Problem solved.
Thank you.
Thank you.
- Sat May 04, 2013 10:34 pm
- Forum: The Nitty and the Gritty
- Topic: Switching between upper and lower case
- Replies: 2
- Views: 4881
Switching between upper and lower case
I can't figure out how to do this: Much of my work involves DNA sequences which I just treat as text. One of the things that I do quite a bit is convert part of a sequence from upper to lower case. Taking this: TATTAGGGATAATAT TCACGCCAGAATGCGTTCGCACA and changing it to this: TATTAGGGATAATAT tcaCGCCA...
- Mon Jan 28, 2013 10:12 pm
- Forum: Mellel
- Topic: Missing cursor next to picture
- Replies: 3
- Views: 3263
Re: Missing cursor next to picture
The problem persists in version 3.1.
Oh well.
Oh well.
- Wed Jan 02, 2013 9:06 pm
- Forum: Mellel
- Topic: Missing cursor next to picture
- Replies: 3
- Views: 3263
Missing cursor next to picture
My documents have quite a few inline images on the left side of the page with the image causing the text to wrap on the right side. The images are rather tall and skinny so there can be half a page or more of text next to the picture. The problem I have is the first character next to the picture, th...